[Taxacom] quote of the week

Richard Zander Richard.Zander at mobot.org
Thu Mar 20 15:04:48 CDT 2008


Why can't morphological evolution of taxa be decoupled from phylogenetic evolution of molecular traits? I think the slogan or maxim that ancestral taxa cannot be phylogenetically complex is in the way. Thus, molecular trees and trees of taxa could well be quite different yet no one is "bad." 

*****************************
Richard H. Zander 
Voice: 314-577-0276
Missouri Botanical Garden
PO Box 299
St. Louis, MO 63166-0299 USA
richard.zander at mobot.org
Web sites: http://www.mobot.org/plantscience/resbot/
and http://www.mobot.org/plantscience/bfna/bfnamenu.htm

For FedEx and UPS use:
Missouri Botanical Garden
4344 Shaw Blvd.
St. Louis, MO 63110
*****************************


-----Original Message-----
From: taxacom-bounces at mailman.nhm.ku.edu [mailto:taxacom-bounces at mailman.nhm.ku.edu] On Behalf Of Brian O'Meara
Sent: Thursday, March 20, 2008 2:13 PM
To: John Grehan
Cc: taxacom at mailman.nhm.ku.edu
Subject: Re: [Taxacom] quote of the week

On Mar 20, 2008, at 9:49 AM, John Grehan wrote:
> I acknowledge that some may argue that all things may be the same.  
> In the case of the ear I can point to a positional homology - what  
> appears to be an ear is postionally in the same place as another  
> apparent ear. Anyone can go and see that. With positional sequence  
> homology one cannot do that. One has to put one's faith in a  
> theoretical mathematical model of how molecular evolution is  
> believed to have worked.
>
> John Grehan


This sort of discussion periodically flares on taxacom (and often  
with the same participants). Actually looking at the maligned  
molecular data might be a useful approach to the issue. I've included  
a small fasta file of hominidae sequences for cytochrome oxidase II.  
I downloaded it from phylota ( http://loco.biosci.arizona.edu/cgi-bin/ 
sql_getcluster.cgi?ti=9604&cl=61&ntype=1&db=GB159 ), added taxon  
names to the annotations, and trimmed off the regions of DNA present  
in only a subset of the taxa (and if this is a controversial step,  
feel free to get the original data from the above URL and play with  
it directly). One can load this file in a favorite sequence alignment  
program that allows manual alignment (MacClade and Mesquite are  
popular), or even just print out the sequences and truly manually  
align them, and "go and see that" the reasonable alignment is one  
with no indels, even though the sequence data are rather divergent  
(up to 16% pairwise differences) and thus potentially difficult to  
align. For a mitochondrial protein-coding gene, the lack of indels  
and thus trivial alignment is what you'd expect. One can also try  
various "theoretical mathematical models" (Clustal, Muscle, etc.)  
using reasonable parameter values (such as the program default  
values) and verify that these algorithmic approaches return the same  
results as the gold standard eyeball analysis. Of course, one can set  
bizarre parameter values to get wacky results, just as one could  
assert that ears in elephants are homologous with fins in sharks, but  
barring this, in many cases molecular homology statements will be  
reasonable and uncontroversial.

Perhaps the morphological characters are giving the correct answer  
while the molecular data are consistently misleading about hominidae  
relationships, but if so, the explanation has to come from somewhere  
other than some innate arbitrariness of alignment. Sometimes  
alignment IS hard and leads to ambiguous or even erroneous results,  
but often, especially with exons of protein-coding genes, it's just  
not that bad. See for yourself.

Best regards,
Brian O'Meara

 >'gi51104787_ti9601_Pongo_pygmaeus_abelii'
ACTCACCAACACCAGCATCTCAGACGCCCAAGAGATAGAGACTATTTGAACTATCCTACCGGCCATCATCCT 
AATTCTAATCGCCCTCCCATCCCTACGCATCCTCTACTTAACAGACGAGATCAACGACCCTTCCTTCACCAT 
CAAATCAATCGGTCATCAATGATACTGAACCTACGAGTACACTGACTACGGTGGATTGATCTTCAACTCTTA 
CATGCTCCCACCACTATTCCTAGAACCAGGCGACCTTCGACTCCTCGACGTCGACAACCGAGTAGTCCTCCC 
AGTCGAAGCTCCCGTTCGCATAATAATCACATCCCAAGACGTCTTACACTCATGAACTGTACCCTCACTAGG 
CCTGAAAACGGACGCAATCCCCGGACGCCTAAACCAAACCACATTCACTGCCACGCGACCAGGAGTGTACTA 
TGGCCAATGCTCAGAAATCTGTGGAGCTAACCACAGCTTTATGCCTATCGTCCTAGAACTAATCCCCC
 >'gi51104761_ti91950_Pan_troglodytes_vellerosus'
ACTAACTAATACTAGTATTTCAGACGCCCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATCATCCT 
AGTCCTTATTGCCCTACCATCCCTCCGTATCCTTTACATAACAGACGAGGTCAACGACCCCTCCTTTACTAT 
TAAATCAATCGGCCATCAATGATATTGAACCTACGAATACACCGACTACGGCGGGCTAATCTTCAACTCCTA 
CATACTCCCCCCATTATTTCTAGAACCAGGTGATCTACGACTCCTTGACGTTGATAACCGAGTGGTCCTCCC 
AGTTGAAGCCCCCGTTCGTATAATAATTACATCACAAGATGTTCTACACTCATGAGCTGTTCCCACATTAGG 
CCTAAAAACAGACGCAATTCCCGGACGCCTAAACCAAACCACTTTCACCGCCACACGACCAGGAGTATACTA 
CGGCCAATGCTCAGAAATCTGTGGAGCAAACCACAGTTTTATACCCATCGTCCTAGAATTAATCCCTC
 >'gi1743318_ti9602_Pongo_pygmaeus_pygmaeus'
ACTCACCAACACTAACATCTCAGATGCCCAAGAGATAGAAACTATTTGAACTATCCTACCAGCCATCATCCT 
AATTCTAATCGCCCTCCCATCTCTACGCATCCTCTACTTAACAGACGAAATCAACGACCCTTCCTTCACCAT 
TAAATCAATCGGCCATCAATGATACTGAACCTACGAGTATACTGACTATGGCGGATTGATCTTCAACTCTTA 
CATGCTCCCACCACTATTCCTAGAACCAGGCGACCTTCGACTCCTAGACGTCGACAATCGAGTAGTCCTCCC 
AGTCGAAGCCCCCGTTCGCATAATAATCACATCCCAGGACGTCTTGCACTCATGAACCGTCCCCTCACTAGG 
CCTGAAAACAGACGCAATCCCCGGACGCCTAAACCAAACCACATTCACTGCCACACGACCAGGAGTATATTA 
TGGCCAATGCTCAGAAATCTGTGGAGCTAACCACAGCTTTATGCCTATCGTCCTAGAACTAATCCCCC
 >'gi51104763_ti37010_Pan_troglodytes_schweinfurthii'
ACTAACTAATACTAGTATTTCAGACGCCCAGGAAATAGAGACCGTCTGAACTATCCTGCCCGCCATCATCCT 
AGTCCTTATTGCCCTACCATCCCTGCGTATCCTTTACATAACAGACGAGGTCAACGACCCCTCCTTTACTAT 
TAAATCAATCGGCCATCAATGATATTGAACCTACGAATACACCGACTACGGCGGGCTAATCTTCAACTCCTA 
CATACTCCCCCCATTATTTCTAGAACCAGGTGATCTACGACTCCTTGACGTTGATAACCGAGTGGTCCTTCC 
AGTTGAAGCCCCCGTTCGTATAATAATTACATCACAAGATGTTCTACACTCATGGGCTGTTCCCACATTAGG 
CCTAAAAACAGACGCAATTCCCGGACGCCTAAACCAAACCACTTTCACCGCCACACGACCAGGAGTATACTA 
CGGCCAATGCTCAGAAATCTGTGGAGCAAACCACAGTTTTATACCCATCGTCCTAGAATTAATCCCTC
 >'gi1743320_ti9602_Pongo_pygmaeus_pygmaeus'
ACTCACCAACACTAACATCTCAGATGCCCAAGAGATAGAAACTATTTGAACTATCCTACCAGCCATCATCCT 
AATTCTAATCGCCCTCCCATCTCTACGCATCCTCTACTTAACAGACGAAATCAACGACCCTTCCTTCACCAT 
TAAATCAATCGGCCATCAATGATACTGAACCTACGAATATACTGACTATGGCGGATTGATCTTCAACTCTTA 
CATGCTCCCACCACTATTCCTAGAACCAGGCGACCTTCGACTCCTAGACGTCGACAATCGAGTAGTCCTCCC 
AGTCGAAGCCCCCGTTCGCATAATAATCACATCCCAGGACGTCTTGCACTCATGAACCGTCCCCTCACTAGG 
CCTGAAAACAGACGCAATCCCCGGACGCCTAAACCAAACCACATTCACTGCCACACGACCAGGAGTATATTA 
TGGCCAATGCTCAGAAATCTGTGGAGCTAACCACAGCTTTATGCCTATCGTCCTAGAACTAATCCCCC
 >'gi51104791_ti9601_Pongo_pygmaeus_abelii'
ACTCACCAACACCAGCATCTCAGACGCCCAAGAAATGGAGACTATTTGAACTATCCTACCGGCCATCATCCT 
AATTCTAATCGCCCTCCCATCTCTACGCATCCTCTACTTAACAGACGAGATCAACAACCCTTCCTTCACCAT 
CAAATCAATCGGTCATCAATGATACTGAACCTACGAGTACACTGACTACGGTGGATTGATCTTCAACTCTTA 
CATGCTCCCACCACTATTCCTAGAACCAGGCGACCTTCGACTCCTCGACGTCGACAACCGAGTAGTCCTCCC 
AGTCGAAGCTCCCGTTCGCATAATAATCACATCCCAAGACGTCTTACACTCATGAACTGTACCCTCACTAGG 
CCTAAAAACGGACGCAATCCCCGGACGCCTAAACCAAACCACATTCACTGCCACGCGACCAGGAGTGTACTA 
TGGCCAATGCTCAGAAATCTGTGGAGCTAACCACAGCTTTATGCCTATCGTCCTAGAATTAATCCCCC
 >'gi51104789_ti9601_Pongo_pygmaeus_abelii'
ACTCACCAACACCAGCATCTCAGACGCCCAAGAGATAGAGACTATTTGAACTATCCTACCGGCCATCATCCT 
AATTCTAATCGCCCTCCCATCCCTACGCATCCTCTACTTAACAGACGAGATCAACGACCCTTCCTTCACCAT 
CAAATCAATCGGTCATCAATGATACTGAACCTACGAGTACACTGACTACGGTGGATTGATCTTCAACTCTTA 
CATGCTCCCACCACTATTCCTAGAACCAGGCGACCTTCGACTCCTCGACGTCGACAACCGAGTAGTCCTCCC 
AGTCGAAGCTCCCGTTCGCATAATAATCACATCCCAAGACGTCTTACACTCATGAACTGTACCCTCACTAGG 
CCTGAAAACGGACGCAATCCCCGGACGCCTAAACCAAACCACATTCACTGCCACGCGACCAGGAGTGTACTA 
TGGCCAATGCTCAGAAATCTGTGGAGCTAACCACAGCTTTATGCCTATCGTCCTAGAACTAATCCCCC
 >'gi549964_ti9600_Pongo_pygmaeus'
ACTCACCAACACTAACATCTCAGATGCCCAAGAGATAGAAACTATTTGAACTACCCTACCAGCCATCATCCT 
AATTCTAATCGCCCTCCCATCTCTACGCATCCTCTACTTAACAGACGAAATCAACGACCCTTCCTTCACCAT 
TAAATCAATCGGCCATCAATGGTACTGAACCTACGAGTATACTGACTATGGCGGATTGATCTTCAACTCTTA 
CATGCTCCCACCACTATTCCTAGAACCAGGCGACCTTCGACTCCTAGACGTCGACAATCGAGTAGTCCTCCC 
AGTCGAAGCCCCCGTTCGCATAATAATCACATCCCAAGACGTCTTGCACTCATGAACCGTCCCCTCACTAGG 
CCTGAAAACAGACGCAATCCCCGGACGCCTAAACCAAACCACATTCACTGCCACACGACCAGGAGTATATTA 
TGGCCAATGCTCAGAAATCTGTGGAGCTAACCACAGCTTTATGCCTATCGTCCTAGAACTAATCCCCC
 >'gi549966_ti9600_Pongo_pygmaeus'
ACTCACCAACACCAGCATCTCAGACGCCCAAGAAATGGAGACTATTTGAACTATCCTACCGGCCATCATCCT 
AATTCTAATCGCCCTCCCATCTCTACGCATCCTCTACTTAACAGACGAGATCAACGACCCTTCCTTCACCAT 
CAAATCAATCGGTCATCAATGATACTGAACCTACGAGTACACTGACTACGGTGGATTGATCTTCAACTCTTA 
CATGCTCCCACCACTATTCCTAGAACCAGGCGACCTTCGACTCCTCGACGTCGACAACCGAGTAGTCCTCCC 
AGTCGAAGCTCCCGTTCGCATAATAATCACATCCCAAGACGTCTTACACTCATGAACTGTACCCTCACTAGG 
CCTAAAAACGGACGCAATCCCCGGACGCCTAAACCAAACCACATTGACTGCCACGCGACCAGGAGTGTACTA 
TGGCCAATGCTCAGAAATCTGTGGAGCCAACCACAGCTTTATGCCTATCGTCCTAGAATTAATCCCCC
 >'gi51104783_ti9600_Pongo_pygmaeus'
ACTCACCAACACTAACATCTCAGATGCCCAAGAGATAGAAACTATTTGAACTATCCTACCAGCCATCATCCT 
AATTCTAATCGCCCTCCCATCTCTACGCATCCTCTACTTAACAGACGAAATCAACGACCCTTCCTTCACCAT 
TAAATCAATCGGCCATCAATGATACTGAACCTACGAGTATACTGACTATGGCGGATTGATCTTCAACTCTTA 
CATGCTCCCACCACTATTCCTAGAACCAGGCGACCTTCGACTCCTAGACGTCGACAATCGAGTAGTCCTCCC 
AGTCGAAGCCCCCGTTCGCATAATAATCACATCCCAGGACGTCTTGCACTCATGAACCGTCCCCTCACTAGG 
CCTGAAAACAGACGCAATCCCCGGACGCCTAAACCAAACCACATTCACTGCCACACGACCAGGAGTATATTA 
TGGCCAATGCTCAGAAATCTGTGGAGCTAACCACAGCTTTATGCCTATCGTCCTAGAACTAATCCCCC
 >'gi51104785_ti9600_Pongo_pygmaeus'
ACTCACCAACACTAACATCTCAGATGCCCAAGAGATAGAAACTATTTGAACTATCCTACCAGCCATTATCCT 
AATTCTAATCGCCCTCCCATCTCTACGCATCCTCTACTTAACAGACGAAATCAACGACCCTTCCTTCACCAT 
TAAATCAATCGGCCATCAATGATACTGAACCTACGAGTATACTGACTATGGCGGATTGATCTTCAACTCTTA 
CATGCTCCCACCACTATTCCTAGAACCAGGCGACCTTCGACTCCTAGACGTCGACAATCGAGTAGTCCTCCC 
AGTCGAAGCCCCCGTTCGCATAATAATCACATCCCAGGACGTCTTGCACTCATGAACCGTCCCCTCACTAGG 
CCTGAAAACAGACGCAATCCCCGGACGCCTAAACCAAACCACATTCACTGCCACACGACCAGGAGTATATTA 
TGGCCAATGCTCAGAAATCTGTGGAGCTAACCACAGCTTTATGCCTATCGTCCTAGAACTAATCCCCC
 >'gi51104755_ti9593_Gorilla_gorilla'
GCTAACTAACACCAACATCTCAGACGCCCAAGAAATAGAGACCATCTGAACCATCCTGCCCGCTATTATCTT 
AGTCCTGATCGCCCTCCCATCTCTACGAATCCTCTATATGACAGATGAAATCAATGACCCCTCCTTCACTAT 
CAAATCAATCGGTCACCAATGATACTGAACCTACGAATACACCGACTATGGTGGATTGATCTTTAACTCCTA 
TATACTCCCCCCATTATTCCTAGAACCAGGTGACCTACGACTCCTTGACGTCGACAACCGAGTAGTCCTTCC 
AGTTGAAGCCCCCGTCCGTATAATAATTACATCCCAAGATGTCTTACACTCATGAGCTGTTCCCACATTAGG 
CCTAAAAACAGACGCAATCCCCGGACGCCTGAACCAAACCACATTCACCGCCACACGACCAGGAGTATACTA 
CGGCCAGTGCTCAGAAATCTGTGGAGCCAACCACAGTTTTATGCCCATTGTTCTAGAGCTAATCCCCC
 >'gi51104753_ti9593_Gorilla_gorilla'
GCTAACTAACACCAACATCTCAGACGCCCAAGAAATAGAGACCATCTGAACCATCCTGCCCGCTATTATCTT 
AGTCCTGATCGCCCTCCCATCTCTACGAATCCTCTATATGACAGATGAAATCAATGACCCCTCCTTCACTAT 
CAAATCAATCGGTCACCAATGATACTGAACCTACGAATACACCGACTATGGTGGATTGATCTTTAACTCCTA 
TATACTCCCCCCATTATTCCTAGAACCAGGTGACCTACGACTCCTTGACGTCGACAACCGAGTAGTCCTTCC 
AGTTGAAGCCCCCGTCCGTATAATAATTACATCCCAAGATGTCTTACACTCATGAGCTGTTCCCACATTAGG 
CCTAAAAACAGACGCAATCCCCGGACGCCTGAACCAAACCACATTCACCGCCACACGACCAGGAGTATACTA 
CGGCCAGTGCTCAGAAATCTGTGGAGCCAACCACAGTTTTATGCCCATTGTTCTAGAGCTAATCCCCC
 >'gi51104751_ti9593_Gorilla_gorilla'
GCTAACTAACACCAACATCTCAGACGCCCAAGAAATAGAGACCATCTGAACCATCCTGCCCGCTATTATCTT 
AGTCCTGATCGCCCTCCCATCTCTACGAATCCTCTATATGACAGATGAAATCAATGACCCCTCCTTCACTAT 
CAAATCAATCGGTCACCAATGATACTGAACCTACGAATACACCGACTATGGTGGATTGATCTTTAACTCCTA 
TATACTCCCCCCATTATTCCTAGAACCAGGTGACCTACGACTCCTTGACGTCGACAACCGAGTAGTCCTTCC 
AGTTGAAGCCCCCGTCCGTATAATAATTACATCCCAAGATGTCTTACACTCATGAGCTGTTCCCACATTAGG 
CCTAAAAACAGACGCAATCCCCGGACGCCTGAACCAAACCACATTCACCGCCACACGACCAGGAGTATACTA 
CGGCCAGTGCTCAGAAATCTGTGGAGCCAACCACAGTTTTATGCCCATTGTTCTAGAGCTAATCCCCC
 >'gi51104749_ti9593_Gorilla_gorilla'
GCTAACTAACACCAACATCTCAGACGCCCAAGAAATAGAGACCATCTGAACCATCCTGCCCGCTATTATCTT 
AGTCCTGATCGCCCTCCCATCTCTACGAATCCTCTATATGACAGATGAAATCAATGACCCCTCCTTCACTAT 
CAAATCAATCGGTCACCAATGATACTGAACCTACGAATACACCGACTATGGTGGATTGATCTTTAACTCCTA 
TATACTCCCCCCATTATTCCTAGAACCAGGTGACCTACGACTCCTTGACGTCGACAACCGAGTAGTCCTTCC 
AGTTGAAGCCCCCGTCCGTATAATAATTACATCCCAAGATGTCTTACACTCATGAGCTGTTCCCACATTAGG 
CCTAAAAACAGACGCAATCCCCGGACGCCTGAACCAAACCACATTCACCGCCACACGACCAGGAGTATACTA 
CGGCCAGTGCTCAGAAATCTGTGGAGCCAACCACAGTTTTATGCCCATTGTTCTAGAGCTAATCCCCC
 >'gi549956_ti9593_Gorilla_gorilla'
GCTAACTAACACCAACATCTCAGACGCCCAAGAAATAGAGACCATCTGAACCATCCTGCCCGCTATTATCTT 
AGTCCTGATCGCCCTCCCATCTCTACGAATCCTCTATATGACAGATGAAATCAATGACCCCTCCTTCACTAT 
CAAATCAATCGGTCACCAATGATACTGAACCTACGAATACACCGACTATGGTGGATTGATCTTTAACTCCTA 
TATACTCCCCCCATTATTCCTAGAACCAGGTGACCTACGACTCCTTGACGTCGACAACCGAGTAGTCCTTCC 
AGTTGAAGCCCCCGTCCGTATAATAATTACATCCCAAGATGTCTTACACTCATGAGCTGTTCCCACATTAGG 
CCTAAAAACACACGCAATCCCCGGACGCCTGAACCAAACCACATTCACCGCCACACGACCAGGAGTATACTA 
CGGCCAGTGCTCAGAAATCTGTGGAGCCAACCACAGTTTTATGCCCATTGTTCTAGAGCTAATCCCCC
 >'gi549954_ti9593_Gorilla_gorilla'
GCTAACTAGCACCAACATCTCAGACGCCCAAGAAATAGAGACCATCTGAACCATCCTACCCGCTATTATCTT 
AGTCCTGATCGCCCTCCCATCTCTACGAATCCTCTATATGACAGATGAAATCAATGACCCCTCCTTCACTAT 
CAAATCAATCGGTCACCAATGATACTGAACCTACGAATACACCGACTATGGTGGATTGATCTTTAACTCCTA 
TATACTCCCCCCATTATTCCTAGAACCAGGTGACCTACGACTCCTTGACGTCGACAACCGAGTAGTCCTTCC 
AGTTGAAGCCCCCGTCCGTATAATAATTACATCCCAAGATGTCTTACACTCATGAGCTGTTCCCACATTAGG 
CCTAAAAACAGACGCAATCCCCGGACGCCTGAACCAAACCACATTCACCGCCACACGACCAGGAGTATACTA 
CGGCCAGTGCTCAGAAATCTGTGGAGCCAACCACAGTTTTATGCCCATTGTTCTAGAGCTAATCCCCC
 >'gi337100_ti9593_Gorilla_gorilla'
GCTAACTAGCACCAACATCTCAGACGCCCAAGAAATAGAGACCATCTGAACCATCCTACCCGCTATTATCTT 
AGTCCTGATCGCCCTCCCATCTCTACGAATCCTCTATATGACAGATGAAATCAATGACCCCTCCTTCACTAT 
CAAATCAATCGGTCACCAATGATACTGAACCTACGAATACACCGACTATGGTGGATTGATCTTTAACTCCTA 
TATACTCCCCCCATTATTCCTAGAACCAGGTGACCTACGACTCCTTGACGTCGACAACCGAGTAGTCCTTCC 
AGTTGAAGCCCCCGTCCGTATAATAATTACATCCCAAGATGTCTTACACTCATGAGCTGTTCCCACATTAGG 
CCTAAAAACAGACGCAATCCCCGGACGCCTGAACCAAACCACATTCACCGCCACACGACCAGGAGTATACTA 
CGGCCAGTGCTCAGAAATCTGTGGAGCCAACCACAGTTTTATGCCCATTGTTCTAGAGCTAATCCCCC
 >'gi549960_ti9593_Gorilla_gorilla'
GCTAACTAGCACCAACATCTCAGACGCCCAAGAAATAGAGACCGTCTGAACCATCCTACCAGCTATTATCTT 
AGTCCTGATCGCCCTCCCATCCCTACGAATCCTCTATATGACAGATGAAATCAACGACCCCTCCTTTACTAT 
CAAATCAATCGGTCACCAATGATACTGAACCTACGAATACACCGACTATGGTGGATTGATCTTTAACTCTTA 
CATACTCCCTCCATTATTCCTAGAACCAGGTGACCTACGACTCCTTGACGTCGACAACCGAGTAGTCCTTCC 
AGTTGAAGCCCCCGTCCGTATAATAATTACATCCCAAGATGTCTTACACTCATGAGCTGTTCCCACATTAGG 
CCTAAAAACAGACGCAATCCCCGGGCGCCTGAACCAAACCACATTTACCGCCACACGACCAGGGCTATACTA 
CGGCCAGTGCTCAGAAATCTGTGGAGCCAACCACAGTTTTATGCCCATTGTCCTAGAGCTAATCCCCC
 >'gi549958_ti9593_Gorilla_gorilla'
GCTAACTAGCACCAACATCTCAGACGCCCAAGAAATAGAGACCGTCTGAACCATCCTACCAGCTATTATCTT 
AGTCCTGATCGCCCTCCCATCCCTACGAATCCTCTATATGACAGATGAAATCAACGATCCCTCCTTTACTAT 
CAAATCAATCGGTCACCAATGATACTGAACCTACGAATACACCGACTATGGTGGATTGGTCTTTAACTCTTA 
CATACTCCCTCCATTATTCCTAGAACCAGGTGACCTACGACTCCTTGACGTCGACAACCGAGTAGTCCTTCC 
AGTTGAAGCCCCCGTCCGTATAATAATTACATCCCAAGATGTCTTACACTCATGAGCTGTTCCCACATTAGG 
CCTAAAAACAGACGCAATCCCCGGGCGCCTGAACCAAACCACATTTACCGCCACACGACCAGGGGTATACTA 
CGGCCAGTGCTCAGAAATCTGTGGAGCCAACCACAGTTTTATGCCCATTGTCCTAGAACTAATCCCCC
 >'gi530080_ti9597_Pan_paniscus'
ACTAACTAATACTAGTATTTCAGACGCCCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATCATCCT 
AGTCCTTATTGCCCTTCCATCTCTACGTATCCTTTATATAACAGACGAGGTCAACGACCCCTCCTTTACTAT 
TAAATCAATCGGCCATCAATGATATTGAACCTACGAATACACCGACTACGGCGGACTAATCTTCAACTCCTA 
CATACTCCCCCCATTATTTCTAGAACCAGGCGACCTACGACTCCTTGACGTTGATAACCGGGTGGTCCTCCC 
AGTTGAAGCCCCCGTTCGTATAATAATTACATCACAAGATGTTCTACACTCATGAGCTGTTCCCACATTAGG 
CCTAAAAACAGACGCAATTCCCGGACGCCTAAACCAAACCACTTTCACCGCCACACGACCAGGAGTATACTA 
CGGCCAATGCTCAGAAATCTGTGGAGCAAACCACAGTTTTATACCCATCGTCCTAGAGTTAATCCCCC
 >'gi51104757_ti9597_Pan_paniscus'
ACTAACTAATACTAGTATTTCAGACGCCCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATCATCCT 
AGTCCTTATTGCCCTTCCATCTCTACGTATCCTTTATATAACAGACGAGGTCAACGACCCCTCCTTTACTAT 
TAAATCAATCGGCCATCAATGATATTGAACCTACGAATACACCGACTACGGCGGACTAATCTTCAACTCCTA 
CATACTCCCCCCATTATTTCTAGAACCAGGCGACCTACGACTCCTTGACGTTGATAACCGGGTGGTCCTCCC 
AGTTGAAGCCCCCGTTCGTATAATAATTACATCACAAGATGTTCTACACTCATGAGCTGTCCCCACATTAGG 
CCTAAAAACAGACGCAATTCCCGGACGCCTAAACCAAACCACTTTCACCGCCACACGACCAGGAGTATACTA 
CGGCCAATGCTCAGAAATCTGTGGAGCAAACCACAGTTTTATACCCATCGTCCTAGAGTTAATCCCCC
 >'gi549962_ti9597_Pan_paniscus'
ACTAACTAATACTAGTATTTCAGACGCCCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATCATCCT 
AGTCCTTATTGCCCTTCCATCTCTACGTATCCTTTATATAACAGACGAGGTCAACGACCCCTCCTTTACTAT 
TAAATCAATCGGCCATCAATGATATTGAACCTACGAATACACCGACTACGGCGGACTAATCTTCAACTCCTA 
CATACTCCCCCCATTATTTCTAGAACCAGGCGACCTACGACTCCTTGACGTTGATAACCGGGTGGTACTCCC 
AGTTGAAGCCCCCGTTCGTATAATAATTACATCACAAGATGTTCTACACTCATGAGCTGTCCCCACATTAGG 
CCTAAAAACAGACGCAATTCCCGGACGCCTAAACCAAACCACTTTCACCGCCACACGACCAGGAGTATACTA 
CGGCCAATGCTCAGAAATCTGTGGAGCAAACCACAGTTTTATACCCATCGTCCTAGAGTTAATCCCCC
 >'gi530078_ti9597_Pan_paniscus'
ACTAACTAATACTAGTATTTCAGACGCCCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATCATCCT 
AGTCCTTATTGCCCTTCCATCTCTACGTATCCTTTATATAACAGACGAGGTCAACGACCCCTCCTTTACTAT 
TAAATCAATCGGCCATCAATGATATTGAACCTACGAATACACCGACTACGGCGGACTAATCTTCAACTCCTA 
CATACTCCCCCCATTATTTCTAGAACCAGGCGACCTACGACTCCTTGACGTTGATAACCGGGTGGTCCTCCC 
AGTTGAAGCCCCCGTTCGTATAATAATTACATCACAAGATGTTCTACACTCATGAGCTATCCCCACATTAGG 
CCTAAAAACAGACGCAATTCCCGGACGCCTAAACCAAACCACTTTCACCGCCACACGACCAGGAGTATACTA 
TGGCCAATGCTCAGAAATCTGTGGAGCAAACCACAGTTTTATACCCATCGTCCTAGAGTTAATCCCCC
 >'gi51104759_ti37011_Pan_troglodytes_troglodytes'
ACTAACTAATACTAGTATTTCAGACGCCCAGGAAATAGAGACCGTCTGAACTATCCTGCCCGCCATCATCCT 
AGTCCTTATTGCCCTACCATCCCTGCGTATCCTTTACATAACAGACGAGGTCAACGACCCCTCCTTTACTAT 
TAAATCAATCGGCCATCAATGATATTGAACCTACGAATACACCGACTACGGCGGGCTAATCTTCAACTCCTA 
CATACTCCCCCCATTATTTCTAGAACCAGGTGATCTACGACTCCTTGACGTTGATAACCGAGTGGTCCTCCC 
AGTTGAAGCCCCCGTTCGTATAATAATTACATCACAAGATGTTCTACACTCATGGGCTGTACCCACATTAGG 
CCTAAAAACAGACGCAATTCCCGGACGCCTAAACCAAACCACTTTCACCGCCACACGACCAGGAGTATACTA 
CGGCCAATGCTCAGAAATCTGTGGAGCAAACCACAGTTTTATACCCATCGTCCTAGAGTTAATCCCTC
 >'gi51104765_ti37012_Pan_troglodytes_verus'
ACTAACTAATACTAGTATTTCAGACGCCCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATCATCCT 
AGTCCTTATTGCCCTACCATCCCTGCGTATCCTTTACATAACAGACGAGGTCAACGACCCCTCCTTTACTAT 
TAAATCAATCGGCCATCAATGATATTGAACCTACGAATACACCGACTACGGCGGGCTAATCTTCAACTCCTA 
CATACTCCCCCCATTATTTCTAGAACCAGGTGATCTACGACTCCTTGACGTTGATAACCGAGTGGTCCTCCC 
AGTTGAAGCCCCCGTTCGTATAATAATTACATCACAAGATGTTCTACACTCATGAGCTGTTCCCACATTAGG 
CCTAAAAACAGACGCAATTCCCGGACGCCTAAACCAAACCACTTTCACCGCCACACGACCAGGAGTATACTA 
CGGCCAATGCTCAGAAATCTGTGGAGCAAACCACAGTTTTATACCCATCGTCCTAGAATTAATCCCTC
 >'gi530082_ti9598_Pan_troglodytes'
ACTAACTAATACTAGTATTTCAGACGCCCAGGAAATAGAGACCGTCTGAACTATCCTACCCGCCATCATCCT 
AGTCCTTATTGCCCTACCATCCCTGCGTATCCTTTACATAACAGACGAGGTCAACGACCCCTCCTTTACTAT 
TAAATCAATCGGCCATCAATGATATTGAACCTACGAATACACCGACTACGGCGGGCTAATCTTCAACTCCTA 
CATACTCCCCCCATTATTTCTAGAACCAGGTGATCTACGACTCCTTGACGTTGATAACCGAGTGGTCCTTCC 
AGTTGAAGCCCCCGTTCGTATAATAATTACATCACAAGATGTTCTACACTCATGGGCTGTTCCCACATTAGG 
CCTAAAAACAGACGCAATTCCCGGACGCCTAAACCAAACCACTTTCACCGCCACACGACCAGGAGTATACTA 
CGGCCAATGCTCAGAAATCTGTGGAGCAAACCACAGTTTTATACCCATCGTCCTAGAATTAATCCCTC
 >'gi549968_ti9598_Pan_troglodytes'
ACTAACTAATACTAGTATTTCAGACGCCCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATCATCCT 
AGTCCTTATTGCCCTACCATCCCTGCGTATCCTTTACATAACAGACGAGGTCAACGACCCCTCCTTTACTAT 
TAAATCAATCGGCCATCAATGATATTGAACCTACGAATACACCGACTACGGCGGGCTAATCTTCAACTCCTA 
CATACTCCCCCCATTATTTCTAGAACCAGGTGATCTACGACTCCTTGACGTTGATAACCGAGTGGTCCTCCC 
AGTTGAAGCCCCCGTTCGTATAATAATTACATCACAAGATGTTCTACACTCATGAGCTGTTCCCACATTAGG 
CCTAAAAACAGACGCAATTCCCGGACGCCTAAACCAAACCACTTTCACCGCCACACGACCAGGAGTATACTA 
CGGCCAATGCTCAGAAATCTGTGGAGCAAACCACAGTTTTATACCCATCGTCCTAGAATTAATCCCTC
 >'gi549970_ti9598_Pan_troglodytes'
ACTAACTAATACTAGTATTTCAGACGCCCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATCATCCT 
AGTCCTTATTGCCCTACCATCCCTCCGTATCCTTTACATAACAGACGAGGTCAACGACCCCTCCTTTACTAT 
TAAATCAATCGGCCATCAATGATATTGAACCTACGAATACACCGACTACGGCGGGCTAATCTTCAACTCCTA 
CATACTCCCCCCATTATTTCTAGAACCAGGTGATCTACGACTCCTTGACGTTGATAACCGAGTGGTCCTCCC 
AGTTGAAGCCCCCGTTCGTATAATAATTACATCACAAGATGTTCTACACTCATGAGCTGTTCCCACATTAGG 
TCTAAAAACAGACGCAATTCCCGGACGCCTAAACCAAACCACTTTCACCGCCACACGACCAGGAGTATACTA 
CGGCCAATGCTCAGAAATCTGTGGAGCAAACCACAGTTTTATACCCATCGTCCTAGAATTAATCCCTC
 >'gi336513_ti9598_Pan_troglodytes'
ACTAACTAATACTAGTATTTCAGACGCCCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATCATCCT 
AGTCCTTATTGCCCTACCATCCCTGCGTATCCTTTACATAACAGACGAGGTCAACGACCCCTCCTTTACTAT 
TAAATCAATCGGCCATCAATGATATTGAACCTACGAATACACCGACTACGGCGGGCTAATCTTCAACTCCTA 
CATACTCCCCCCATTATTTCTAGAACCAGGTGATCTACGACTCCTTGACGTTGATAACCGACTGGTCCTCCC 
AGTTGAAGCCCCCGTTCGTATAATAATTACATCACAAGATGTTCTACACTCATGAGCTGTTCCCACATTAGG 
CCTAAAAACAGACGCAATTCCCGGACGTCTAAACCAAACCACTTTCACCGCCACACGACCAGGAGTATACTA 
CGGCCAATGCTCAGAAATCTGTGGAGCAAACCACAGTTTTATACCCATCGTCCTAGAATTAATCCCTC
 >'gi530076_ti9606_Homo_sapiens'
ACTAACTAATACTAACATCTCAGACGCTCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATCATCCT 
AGTCCTCATCGCCCTCCCATCCCTACGCATCCTTTACATAACAGACGAGGTCAACGATCCCTCCCTTACCAT 
CAAATCAATTGGCCACCAATGGTACTGAACCTACGAGTACACCGACTACGGCGGACTAATCTTCAACTCCTA 
CATACTTCCCCCATTATTCCTAGAACCAGGCGACCTGCGACTCCTTGACGTTGACAATCGAGTAGTACTCCC 
GATTGAAGCCCCCATTCGTATAATAATTACATCACAAGACGTCTTGCACTCATGAGCTGTCCCCACATTAGG 
CTTAAAAACAGATGCAATTCCAGGACGTCTAAACCAAACCACTTTCACCGCTACACGACCAGGGGTATACTA 
CGGTCAATGCTCTGAAATCTGTGGAGCAAACCACAGTTTCATGCCCATCGTCCTAGAATTAATTCCCC




>> -----Original Message-----
>> From: taxacom-bounces at mailman.nhm.ku.edu [mailto:taxacom-
>> bounces at mailman.nhm.ku.edu] On Behalf Of Pierre Deleporte
>> Sent: Thursday, March 20, 2008 9:45 AM
>> To: taxacom at mailman.nhm.ku.edu
>> Subject: Re: [Taxacom] quote of the week
>>
>>
>> self-quotes of the week :
>>
>> Sequences are not passing by '
>> pre-aligned'
>>  out there in nature;
>> but neither do squeletons and anatomies.
>>
>> Morphologists do have '
>> alignment problems'
>> ;
>> some mammals appear to have 12, 13, or 14 pairs of ribs...
>> and snakes can show many more
>> (they were likely paid by vicious molecularists for behaving such a
>> tricky way).
>>
>> Aligning bird and human squeletons was an enlighting biological
>> conjecture,
>> despite the frustrating fact that squeletons themselves obstinately
>> refused to align spontaneously
>> (such a lack of cooperative spirit is absolutely baffling ...).
>>
>> Homologies are concepts, inferred properties,
>> they are not observable material systems or processes (= changes in
>> systems).
>>
>> Ears exist in  nature as things protruding on living beings, not
>> '
>> homologies'
>> ;
>> while homologies do not exist in themselves,
>> except as sequences of thought activities in human brains.
>>
>> When nobody is thinking some homology, no homology is "existing"
>> properly on Earth;
>> (which is not to say that the homology is erroneous when thought).
>>
>> Confusing interpretative concepts with objectively '
>> observable'
>>  material
>> objects
>> or processes has one name (at least): naive positivism (pleonasm).
>>
>> Pierre
>>
>>
>> Hovenkamp, P. (Peter) wrote :
>>> John,
>>>
>>>> From your opponents you require the same infallibility that you  
>>>> claim
>>> for yourself. Both are unrealistic.
>>>
>>> They observe two sequences. They conjecture an alignment.
>>> You observe two ears. You conjecture homology.
>>>
>>> Same difference.
>>>
>>> Peter Hovenkamp
>>>
>>>
>>>> Subject: Re: [Taxacom] quote of the week
>>>>
>>>> I guess it is radical, but then it'
>>>> s the molecularists who have pushed
>>>> the distinction (and superiority) of molecules.
>>>>
>>>> I can observe or define an ear homology as something that exists in
>>>> nature. When alignment is involved, as it is so often,  
>>>> homologies are
>>>> created that do not exist in nature - they are the product of  
>>>> one or
>>>> more alignment programs. So the sequences are empirical, but the  
>>>> cross
>>>> species homologies of sequences are not when they are the  
>>>> product of
>>>> alignment.
>>>>
>>>> John Grehan
>>>>
>>>>
>> --
>> Pierre Deleporte
>> Université de Rennes 1
>> CNRS UMR 6552
>> Station Biologique de Paimpont
>> F-35380 Paimpont   FRANCE
>> Téléphone : 02 99 61 81 63
>> Télécopie : 02 99 61 81 88
>>
>>
>>
>> _______________________________________________
>> Taxacom mailing list
>> Taxacom at mailman.nhm.ku.edu
>> http://mailman.nhm.ku.edu/mailman/listinfo/taxacom
>
> _______________________________________________
> Taxacom mailing list
> Taxacom at mailman.nhm.ku.edu
> http://mailman.nhm.ku.edu/mailman/listinfo/taxacom


_______________________________________________
Taxacom mailing list
Taxacom at mailman.nhm.ku.edu
http://mailman.nhm.ku.edu/mailman/listinfo/taxacom




More information about the Taxacom mailing list